Шановні українські журналісти

Я знаю, що ви мене читаєте. Прочитайте ще раз і схаменіться.

Майже три тижні тому я писала про
ідіотський законопроект від Партії регіонів про заборону ГМО. Жодного резонансу в ЗМІ. Я розумію, за таке можливо ніхто не платить, а можливо і тема вам нецікава.

Тепер увага. Одразу після ініціативи партії регіонів прокинулась
комуністична партія з подібною ініціативою. Це ще більш катастрофічний законопроект за поданням Даниленко. Власне нічого нового в порівнянні з законопроектом Партії регіонів, крім того, що взагалі пропонується все заборонити, а також додати пункт в кримінальний кодекс:

"Діяльність, пов’язана зі створенням, випробуванням та впровадженням ГМО в обіг, виготовлення, продаж та імпорт ГМО і продуктів харчування, які виготовленні з ГМО, або містять його у своєму складі, караються штрафом до десяти тисяч неоподатковуваних мінімумів доходів громадян або обмеженням волі на строк до трьох років. "

Сам текст законопроекту граматично і стилістично неграмотний, ніби написаний запущеним дислексиком.

В пояснювальній записці пишуть ідіотський безграмотний брєд:

" ГМО – це не натуральний продукт. Харчування їжею, яка містить ГМО в майбутньому може призвести до не передбачуваних наслідків для здоров’я.

Експерименти проведені над мишами дають підстави говорити, що вживання ГМО харчів небезпечне для людей. (
Якими мишами?!!!)

Українських громадян і без ГМО з кожним днем стає все менше. Треба берегти свій народ, поки він існує як такий. (
Дешевий популізм – 1!!!)

Держава повинна дбати про здоров’я своїх громадян, а не про комерційні егоїстичні інтереси бізнесменів. (
Дешевий популізм – 2!!!)

Країна ЕС – Польща, вже проголосила свою територію вільною від ГМО. І разом з цим, це їй
не мішає експортувати в Україну продукцію ГМО. Враховуючи факт, що сьогодні Україна з країни експортера перетворилася в державу імпортер, слід хоча б забезпечити умови, при яких іноземна продукція буде якісною. (
По-перше, згідно законодавства ЄС, ГМ-продукція "білої" біотехнології, тобто ензими, вітаміни, ароматизатори, ліки, вакцини і так далі не підпадає під загальну ГМ-заборону, натомість в українській інтерпретації ПІДПАДАЄ. По-друге, шановні комуністи, постидайтесь. В українській мові вираз "не мішає" розмовний, а не літературний)

Україна повинна стати територією без ГМО. (
Боїтесь їсти ГМ сою? селяві. Не їжте! Це хоч і дуже нерозумна стратегія з точки світової перспективи, але кожен народ має право на безпричинні страхи і забобони. Але схаменіться! Пропонується кримінальна відповідальність за імпорт вітамінів і фактично більшості рекомбінатних вакцин, ліків і протеїнів. І всі мовчать?)"

Advertisements

Что происходит в мозгах в момент акта осознания.

Давно что-то я про мозг не писала. Сейчас восполним.

Буквально неделю назад по
СМИ прошло сообщение, дескать обнаружилось, что едва ли не треть случаев коматозных и вегетативных состояний сопровождается нераспознанным наличием сознания у пациентов.

Прикинем масштабы. В Германии на 80 млн жителей ежегодно впадают в кому до 6000 пациентов. Таким образом насобиралось уже 30 000 с разной степенью тяжести комы. Эти состояния условно разделяют на несколько групп и особняком стоят "заживо погребенные" в своем теле, которые при сознании, но общаться с миром не имеют возможности. Так вот, ученые, которые занимаются этой темой утверждают, что количество людей при сознании сильно недооценено. Померяли там какие-то очаги возбуждения в мозгах на вербальные раздражители и получается, что мозг некторых коматозных вполне себе распознает: "Этот чай с сахаром" и "Этот чай с носками". Что характерно, что те мозги, кто при сознании и могут как-то подвать сигналы из тела, чувствуют себя вполне сносно и чудовищных страданий не испытывают, разве что неудобство при общении.

Это все конечно интересно, но остается базовый вопрос, что именно измеряют ученые и чем отличается осознанный процесс от неосознанного. По удачному стечению обстоятельств, днем позже в журнале EDGE
очередной репортаж из научного междусобойчика, который организовывает научный импрессарио Брокман. Я уже писала про журнал, это такая инициатива богатых и умных, собираться время от времени и вести умные беседы с учеными звездами, известными или восходящими на грани науки. В этот раз THE REALITY CLUB заседал в Париже, отель Ritz. Немного понтов, но тем не менее довольно занятно и познавательно. Кто владеет английским, не теряйте тут времени и читайте и смотрите оригинал.

А я тут напою вкратце выжимки доклада
Stanislas Dehaene, французского специалиста в области когнитивной
нейропсихологии.

Речь идет о том, что пока философы-теоретики задаются проблемой, как бы так поаккуратней сформулировать понятие сознания, а также прикинуть, может ли мозг в принципе сам себе изучать, практики делают маааахонькие шаги в экспериментальном распознании процесса сознания. Что там происходит в голове в момент, когда мы осознаем, отличается ли это как-то от неосознанных процессов и можно ли это померять?

Итак, я уже когда-то писала, мозг покоится в темноте черепной коробки, воспринимает сигналы, обрабатывает их и как-то интепретирует. Чтобы отделить сознательный процесс от неосознанного хотя бы в первом приближении, надо сделать шаг назад и минимировать поступающий в мозг сигнал настолько, чтобы малейшее изменение его интенсивности запускало или не запускало акт осознания. То есть ниже порогового значения. Кто не понял, не волнуйтесь, я сейчас приведу пример.

Возьмем, например, короткий визуальный раздражитель. Это может быть слово или цифра. И демонстрируем его подопытному. Можно подобрать такую пороговую длительность демонстрации, приблизительно 50 миллисекунд, когда испытуемый уже не распознает слово. В этом случае говорят об энергии радражителя, которая недостаточная для запуска процесса осознания, но тем не менее мозг ее все равно улавливает. Во время визуального раздражения можно с помощью магнитного резонанса фиксировать активность в разных участках мозга и смотреть что где активируется.

Что обнаружили. В общих словах, когда длительность сигнала очень короткая и испытуемый не распознает буквы, активируются только некоторые участки мозга, причем активация эта короткоживущая и быстро затухает. А вот когда слово посветилось дольше и распознано, в мозге начинают происходить бурные процессы усиления этого сигнала и передачи в другие участки мозга. Но и это еще не все. Происходит также синхронизация работы разных участков для обработки и интерпретации сигнала: ареал Брока (которые отвечает за выбор слов, которые вы собираетесь произнести) информируется об идентичности того, что увидел мозг, гипокампус получает информацию для запоминания, другие участки мозга вовлекаются в принятие решения, что с этой информацией теперь делать, игнорировать или нет и так далее.

Таким образом, за сознательную деятельность мозга отвечает
не отдельный регион. Сознание – это
состояние усиления, обработки, передачи, обмена сигнала и синхронизации активности
между очень многими участками мозга. И это все происходит по лавинообразному принципу, причем первыми получают сигнал глубокие участки мозга. И некоторые процессы вполне сносно моделируются и симулируются на компьютере.

Да, так вот, для чего все это надо? Если я правильно поняла, и неосознанный процесс приводит к накоплению информации и целого ряда интепретаций этой информации, а процесс осознания способствует выбору одной из интерпретаций, которая наиболее релевантна для решения каких-то целей. Анализируя результаты обработки коротких "невидимых" визуальных раздражений и длительных, осознанных, ученые пришли к выводу, что все эти рекламные эффекты какого-то там кадра большой миф, поскольку возбуждение в мозгу короткоживущее хоть и воспринимается мозгом, но эффект от него небольшой. А осознание позволяет нам захватить сигнал в глобальную нервную сеть и пустить в переработку. И теперь, даже если раздражение прекратилось, мозг может продолжать играть с ним в своем сознании сколько угодно.

Пару экспериментов.

Если взять испытуемого, показать ему "невидимое" какое-то число, а потом предложить выбрать, было ли это число
больше пяти или
меньше, то количество угадываний будет 60% и это больше, чем случайное (которое в этом случае 50%), даже если испытуемый числа не помнит и не осознал.

Если взять испытуемого, показать ему "невидимое" какое-то число, а потом предложить его
назвать, то число угадываний будет уже 40%, что все еще выше случайного (которое в этом случае 25%).

Если усложнить задачу, которая подразумевает поключение сознания, то картина выглядит уже не так оптимистически. Дополнительный шаг обработки информации
уже невозможен.

Если взять испытуемого, показать ему "невидимое" какое-то число, а потом предлжить испытуемому
добавить до этого числа два и затем решить, будет ли результат больше или меньше пяти, то уже угадывание скатывается в случайные величины. Это потому, что
неосознанная обработка короткого сигнала не достигла регионов мозга, ответственных за осуществление таких операций.

Так, что еще можно померять осознанного в мозгу? Еще один тест. Есть такой известный лет 25 пят феномен, когда даже спящий, коматозный и прочий несознательный мозг подает сигналы. Надо дать серию из пяти звуковых сигналов, четыре из которых подряд на одной ноте, а пятый на пару тонов ниже. Вот так: "та-та-та-та-дуууууу". Так вот энцефалограмма даже несознательных и спящих показывает, что мозг не дурак, все слышит и демонстрирует определенные характерные волны. Это несознательные такие волны.

Но вот если дать мозгу настроится на это "та-та-та-та-дуууууу", а затем врубить без изменений "та-та-та-та-та", то только сознательный бордствующий неспящий мозг, воспримет это как новую ситуацию,
сравнит и обнаружит подвох в контексте предыдущих "та-та-та-та-дуууууу" .

Вот это все интересно в будущем в плане расшифровать активности и визуализировать мысли сознательного мозга. Над этим работают.

Петиция в Бундестаг

Очень важно для немецких френдов.

Petition: Wissenschaft und Forschung – Kostenloser Erwerb wissenschaftlicher Publikationen vom 20.10.2009

Текст петиции

Немецкий Бундестаг должен принять решение, чтобы научные публикации, которые получены в результате исследований, финансируемых государством, стали доступными и бесплатными для всех граждан. Учреждения, которые автономно управляют государственным финансированием исследований, должны призвать Бундестаг принять соответствующие правила и создать для этого технические условия.

Обоснование

Согласно информации Федерального министерства образования и научных исследований, на исследования и развитие государственный сектор расходует ежегодно около 12 миллиардов евро. Результаты научных исследований, однако, в основном публикуются в платных журналах. Несправделиво, что налогоплательщик должен платить еще раз за результаты научных исследований, которые он же и профинансировал.

Из-за высокой стоимости и большого числа научных журналов результаты исследований доступны только в нескольких библиотеках. Для большинства граждан доступ к финансиованным ими достижениям науки не только сложен, но на самом деле полностью закрыт. Ограничение граждан от науки является не только вредным, но и лишним. Другие страны уже осуществляются аналогичные проекты. Американская администрация Национальных институтов здравоохранения (НИЗ) требует, чтобы все оплаченные публикации, через 12 месяцев стали доступны для общественности. Базовая структура системы научных публикаций таким образом в результате не изменяется.

Я сделала это!

Новые грани из жизни
progenes

Знаете ли вы, что в свободное время от

клонирования генов, выращивания перцев на даче
, блогомарания, я

крестиком вышиваю
еще чем-то занимаюсь. То есть крестиком я тоже могу, но в этот раз речь не о вышивании.

Я наконец реализовала свою давнюю мечту (с придыханием): лоскутное стеганное одеяло пошила. Хвост кота Монтесумы как масштабная линейка.

Для того, чтобы пошить такое одеяло, надо:

1. В школе на уроках труда получить единственную тройку за четверть и разряд швеи-мотористки.

2. Хитростью уболтать Деда Мороза подарить мне швейную машинку как бы для ремонта дыр на детских штанах.

3. Сходить на википедию, посмотреть на
американский квилт и немножко свихнуться от желания.

4. Заказать каталог для креативного хобби и, пока никто не успел опомниться, закупить ворох больших лоскутов для печворка.

5. Накрошить большие лоскуты в крошечный хлам.

6. Сшить их в кучу.

7. Пустить слезу умиления.

8. Пообещать починить штаны ребенку в следующий раз (коварно вынашивая планы пришить на рваную джинсовую рану пестрый лоскут).

9. UPD: Кому померещился Климт, то он молчаливо взирал на это все безобразие
со стены.

Еще раз о вирусе гриппа. Исследования.

Есть две новости. Спасибо
pan_grunia за наводку! 10 геномных последовательностей "украинских" изолятов вируса гриппа H1N1 прочитаны экспертами ВОЗ и выложены в базу данных вируса гриппа
GISAID.

Все изоляты содержат зловредную мутацию D225G в гене гемагглютинина.

Кого еще не задолбала эта тема, могут лезть под кат читать
многа букав.

Мы легких путей не ищем, поэтому начнем издалека.

А именно,
кто и как изучает вирус гриппа. Я специально это все пишу, чтобы вылить ушат холодной воды на головы заговорщиков, потому как все исследования открытые, хоть и выглядят порой зловеще. Для освежения знаний рекомендую посмотреть
генетику вируса гриппа.

Кто и как изучает актуальный вирус гриппа. Как раз в последнем номере Nature развлекательная статья на эту тему
"Один вирус-киллер – три ключевых вопроса". Ислледования вируса идут по трем основным направлениям:

1. Как он убивает?

2. Как он распространяется?

3. Куда его повернет?

1. Как он убивает?

Отличительная особенность этого вируса от других гриппозных зараз в том, что он поражает не только ткани верхних дыхательных путей, но и проникает в легкие. Мало того, что он проникает, он распознает на человеческих тканях особые гликопротеины и к ним липнет. В то время, как "нормальный" вирус распознает гликопротеины α2,6, свиной вирус распознает также гликопротеины α2,3, которые больше присутствуют в низлежащих легочных тканях. Таким образом изучают как вирус распознает своими гемаггютининами гликопротеины и какие особенности строения этих гемагглютининов критичные для процесса узнавания. Это изучают как в лабораториях Европы, например, в Марбурге, так и в Америке.

2. Как он распространяется?

Для изучения распространения для возможно моделирования ситуаций мало наблюдать текущую ситуацию. Надо также экспериментально наблюдать процесс и это делают на животных и с другими вирусами. Это также необходимо для предсказывания эффективности вакцинации, а также для возможности кросс-реакции вакцины с различными подтипами вирусов.

Самый интересный вопрос:

3. Куда его повернет? Коль скоро мы знаем, что вирус способен не только ре-ассортироваться, но и мутировать в агрессивные варианты, надо бы прикинуть как это может выглядеть. И нет иного пути, как сделать это экспериментально и искусственно, прежде чем вирус сделает это непредсказуемо сам в естественных условиях. И именно этот тип исследований содержит этические возражения – это по сути создание самого зловредного вируса. Так что можно порассуждать, должны ли мы ждать сложа руки, пока он сам мутирует (а он точно смутирует) или действовать на упреждение. Тем не менее, уже исследован целый ряд потенциально опасных мутаций в том самом гемагглютинине.

В
PloS недавно опубликована статья, посвященная таким мутациям. Давайте посмотрим на ген гемагглютинина попристальнее. Kак я рассказывала в предыдущей статье
про BLAST, генную или белковую последовательность можно сравнить с помощью относительно простого алгоритма и посмотреть, какие изменения наблюдались за время различных эпидемий и какие особенности протекания заболевания с этим связаны. Эти ж вирусы не просто так мутируют, а если мутация какая-то ценная для вируса, она фиксируется в вирусной популяции. Также по генным последовательностям можно установить, откуда этот вирус завезли.

Раз уж я в самом начале упомянула мутацию D225G, то давайте рассмотрим ее. Если представить первичную структуру белковой молекулы в виде цепочки аминокислот, то D225G означает, что в звене цепочки с порядковым номером 225 произошла замена аспарагиновй кислоты (D) на глицин (G). Такие замены наблюдались и раньше, а в табличке приведена частота, с которой эти замены наблюдались во время различных эпидемий.

Как мы видим, эта замена D на G наблюдалась в 40% случаев в последовательностей гемагглютинина вируса испанки, хотя тут проанализировано только 5 последовательностей, то есть в 2х с пяти. Также эта замена наблюдалась в вирусах, циркулировавших с 1947 по 1957 года (около 80ти%), а после 1979 и до 2008 года практически не встречалась. В актуальной эпидемии до сих пор наблюдался только в 1.4% из всех проанализированных изолятов.

Роль этой замены была непонятна. Эта 225 аминокислота скорее всего имеет смысл "в компании" с аминокислотой D или Е под номером 190. Этак 190я кислота очень консервативна и они вдовоем видимо определяют специфичность субстрата. Как это узнали? Взяли "исходный" варинант вируса испанки с аминокислотой D225 и смутрировали ее на G225, а затем проверили эффективность связывания с вышеупомянутыми гликопротеинами α2,3 (которые в носоглотке) и α2,6 (которые в легких). И показали, что в результате этой замены, кроме способности липнуть к гликопротеину α2,3 вирус приобретает способность к узнаванию гликопротеина α2,6. Это табличка из статьи в
Nature.

Table 1. Titer of virus stocks prepared on MDCK cells with trypsin (1 µg/ml, Sigma) and incubated at 37°C with 5% CO2 for 48 hours. Hemagglutination assay of viruses used 0.5% {alpha}-2,3-resialylated CRBCs, {alpha}-2,6-resialylated CRBCs, or untreated CRBCs. The results shown correspond to four hemagglutination units. Similar results were obtained when viruses were adjusted to 8, 16, or 32 hemagglutination units with untreated CRBCs.

Amino acid position (H3 numbering)


Presence or absence of hemagglutination


190 225 Infectivity titer (pfu/ml) {alpha}2,6 CRBCs {alpha}2,3 CRBCs Untreated CRBCs

SC18 D D 4.8 x 107 + +
NY18 D G 3.3 x 107 + + +
AV18 E G 5.0 x 107 + +
Dk/Alb E G 2.2 x 107 + +

И вот, как оказалась, в Украине свирепствует предположительно именно эта мутация гриппа. И еще важное, что обнаружили, этот изолят находится не столько в носоглоточных смывах, сколько в легочных тканях. Поэтому практикуемый анализ смывов ее плохо определяет. Украинский вирус представляет замечательный пример мутаций, которая возникла в результате рекомбинации. Одна аминокислотная замена может получаться при нескольких различных вариантах нуклеотидных мутаций и особенность "украинской" мутации в том, что она ранее в человеческом гриппе не встречалась, но встречалась в свином. Что это значит? Ну пока ничего не значит кроме того, что у нас вирус скорее всего чуть поаггрессивнее того же немецкого и стремится в легкие. А дальше надо просто продолжать изучать. Ну и еще я, пожалуй, бы добавила, что это дополнительный аргумент для вакцинации.

По материалам:
RBD Change D225G in Ukraine Lungs Raises Concerns
All Fatal Ukraine Cases at GISAID Have RBD D225G

Гены и безопасность

Технология работы с генами подошла к такому рубежу, перед которым соображения об опасности "конвернциональных" ГМО выглядят как детский лепет.

Например, я сейчас занята анализом более чем 50ты тысяч генных последовательностей одновременно. Как это делается. Я выделила из растительных тканей РНК. Это несложно. Затем с помощью фермента обратной транскриптазы я "переписала" их в последовательности ДНК. Это называется кДНК. Это тоже несложно. Затем я отправила их на секвенаторную фирму для прочитки. На выходе я получаю обычный текстовой файл, который простой и незамысловатый. Выглядит вот так
) :

>Ps2001

CTTAATAAAACCCCTCGCGTTGATGAAACTTGAAGGGTAA
AAATGAATTAACCCAGGCAA

CTCACCAATATTAGAAGCCTGAGTTGGTGAAAATATTCTA
CTATACACGTGAGGACAATA

>Ps2002

CCATCTGCCACTCATGTCAATCAGAATCAATTATTAAACC
TTACATCCAGTGAAGGGAGG

CGAGAGCCATCTGGAAATTTGTCAACTACCAGCATGACTG
ATGCTCAAGCTGCAGGGAAG

>Ps2003

ACGGGGAAACGGGACGATTCAGAACTGTGTGACAAAGAGA
CTCCGAAAGAGTGAAACGGA

AAAATGGGAAGGAAGAAAGGGTAATGTCGAATTCGAGGAA
TCTCCACCGGACGATTTTGA

TCCGGCGAATCCTTACAAGGATCCGGTGGCTATGTTGGAG
ATGAGGGAACACATCGTCAG

AGAAAAATGGATCCAAATTGAAAAGGCTAAGATTATTAGG
GAAAAGCTTCGTTGGTGTTA

>Ps2004

AATCTTGTTTGAAACAAAAAAGTAATCGCTAAATTCAAAA
TCAATCTTGTACCAGTACAA

TAAAAAGAACAAAAAATAAAACAAACTGCATAACAAGGTA
AAAACAAAATACTCAAACAA

AAAAACAAAACTAAGGAAAAATAGCAACCCACGCCAGAGT
TTGCCGGGAATGTAAGTTTT

Я немного пообрезала последовательности для удобства. Обычно они длиннее. Как мы видим, все последовательности разделены тэгами ">" и содержат какое-то условное название: одно название – условно говоря один ген. Как я уже сказала, в файле сейчас около 50 тыщ последовательностей, но сегодняшние возможности позволяют за раз получить пару миллионов. Что мне с ними делать?

Следующий этап работы с этими последовательностями называется
сравнительная геномика: надо взять эти последовательности и сравнить с уже известными. Я могу сравнивать как поодиночке, так и все одновременно. Я могу также сравнивать как нуклеотидные последовательности, так и виртуально протранслировать эти последовательности в белок и сравнить с базами данных белков. Это все делается
в полностью открытых для всех базах данных и называется это сравнение
BLAST (аббревиатура от Basic Local Alignment Search Tool). На лабораторном жаргоне это называется "бластить". Это не просто, это очень просто. Каждый из вас может это сделать и узнать, на какой ген похожа последовательность >Ps2001.

Для этого надо зайти на
эту страничку и скопировать в окно последовательность, которую охота пробластить, нажать внизу страницы большую кнопку BLAST и подождать. Можете для интереса попробовать с первой последовательностью и убедиться, что она похожа на некую
последовательность из чечевицы. Практически все генные и геномные последовательности хранятся в этой базе данных и каждая из них имеет вот такую учетную карточку, где написано, что это за ген, кем и когда выделен, из какого организма и если известна его функция, то и это тоже указано. Там есть также практически все геномы, которые просеквенированы, а также геномные последовательности вирусов.

Когда я узнала побольше об этой последовательности и она оказалась для меня интересной, я могу выделить ее из генома в целом виде в помощью
ПЦР. Это называется клонирование. Теперь эта последовательность у меня в виде материальной молекулы. Если мне лень возиться с клонированием, то я можу отравить последовательность на фирму и они мне насинтезируют. Я также на свое усмотрение могу изменить нативную последовательность, например с целью поизучать эффект от мутации. Вот тут начинается то, ради чего я пишу этот пост.

Сегодня на рынке несколько фирм, предлагающие подобный сервис. Например
DNA2.0 в Америке или
Geneart в Германии, которые обслуживают всю Европу. Виртуально любой желающий может заказать там молекулу ДНК любого гена на свое усмотрение. И это может быть не добрый растительный ботан с геном гликозил гидролазы, который работает в наглухо зарегулированном научном учреждении, а злодей-биотеррорист с мутантным геном вруса оспы, который в конкурентной гонке за постоянную позицию в университете проиграл, но навыков клонирования не утратил, потому особенно зол.

В общем ситуация ясна и требует назамедлительного решения. Поэтому генные синтезаторы прикинули и решили создать
security coalition, которая называется International Gene Synthesis Consortium (IGSC), а также выработать стратегию защиты. Таким образом, скоро лафа для хобби-бластеров закончится. Все заказанные гены на синтез будут проходить обязательную проверку на потенциальную опасность.