Лабораторные байки

Я тут гены на биочипах смотрю, какие включились, а какие выключились. Раньше образцы на фирму отправляли, но с некоторые пор у нас завелись приборы хитромудрые, так что сами химичим. Должна сказать, что в последнее время технология рванула, хоть и требует прилежания и аккуратности, но все такое стандартизированное, нано-пренано. Сливаю по микролитрам, что-то там в махоньких пробирочках инкубирую и наношу в микродозах на микростекла в стерильных безпылевых безозоновых лабораторих.

А сверху накрываю

стеклом,на котором примерно 2 на 4 см нанесено 500 тыщ нано-гено-точек. Вот таким

Это вступление, чтоб представить, какое оно все ми-ми-мишное.

Но что характерно, что в процессе протокола такого всего точного, хрупкого, отточеного и аккуратного, встречаются чудовищные баги. Например, после нанесении проб на стекла и упаковки чипа в такой металлический контейнер (это все не дыша, не дотрагиваясь до краев и не дрожащей рукой, быстро и точно),

этот контейнер надо взять крепко в руку и
изо всех сил шарахнуть (именно, что шарахнуть) им об твердую поверхность, чтобы воздушные пузыри, которые там образовались, оторвались от края и стали свободно плавать. По столу стучать нельзя, там сканер. Поэтому для этого дела используется центрифуга, которая стоит под столом. Хотели уже убрать центрифугу, но оказалось, что нет более подходящего места для избиения контейнеров.

Или, например, современные приборы для анализа нуклеиновых кислот, вроде биоаналайзера. Там пробы

заливаются в такой вот чип

.

Согласно инструкции от производителя, все просто



На самом же деле, чип надо подготовить и залить туда 9 микролитров геля под давлением из шприца. Это искусство. Я каждый раз, когда заливаю, не перестаю удивляться. Надо шприцом создать давление (плавно, но сильно). Зафиксировать поршень на 30 секунд (быстро), потом отпустить фиксаж (очень быстро), но поршень держать пальцем еще ровно 5 секунд (зачем-то). Потом отпустить поршень (нежно), который под давлением будет возвращаться в исходное положение (медленно). Но в исходную точку он сам возвратиться не может (почему-то) и последние 8 миллиметров ему надо помочь (медленно, но не очень). Так в протоколе.

Intuitive Biostatistics

Попробуем теперь разобраться с задачками. В комментарии наведывались суровые статистики, у которых формулы математицкие. Я попробую объяснить логику рассуждений для тех, кто с формулами не дружит. Кое в чем и сама, наконец, разобралась.

Под катом таблички.

Задача 1

Задача 2

Задача 3

Задача 4

Поскольку я на переправе меняла коней, то некоторые по умолчанию считали количество фальш-позитивных 5%, пока я не уточнила, что фальш-позитивных как бы нет. Однако этот тупой пример позволяет распознать два важных параметра: чувствительность теста и специфичность теста.

Чувствительность – это какой % больных демонстрируют позитивный результат 95% (Задача 1-3) или 99,5%(Задача 4).

Специфичность – это какой % здоровых демонстрируют негативный результат (опять 95%, это 100%-5%), или 100%, как в последней задаче уточнено в процессе обсуждения. Мы можем, например, поиграться и предположить, что 3% здоровых почему-то продемонстрируют аномальный результат. Тогда финал будет выглядеть так:

За подготовку задачи и объяснение для чайников благодарность объявляется учебнику для

дураков
биологов от Harvey Motulsky "Intuitive Biostatistics", раздел 14 "Intrepreting Lab Tests: Introduction to Bayesian Thinking", страница 133.

А теперь займемся арифметикой!

Сова приложила ухо к груди Буратино.
— Пациент скорее мертв, чем жив, — прошептала она и отвернула
голову назад на сто восемьдесят градусов.
Жаба долго мяла влажной лапой Буратино. Раздумывая, глядела выпученными глазами сразу в разные стороны. Прошлепала большим ртом:
— Пациент скорее жив, чем мертв…
Народный лекарь Богомол сухими, как травинки, руками начал дотрагиваться до Буратино.
— Одно из двух, — прошелестел он, — или пациент жив, или он умер. Если он жив — он останется жив или он не останется жив. Если он мертв — его можно оживить или нельзя оживить.
— Шшшарлатанство, — сказала Сова, взмахнула мягкими крыльями и улетела на темный чердак
.

kondybas Задачку подогнал замечательную. Я немного переиначу, но суть останется та же.

Задачка 1. Известно о наличии редкого наследственного заболевания, которое встречается у 1го деревянного пациента на 10000 , то есть 0.01%. Консилиум врачей решил превентивно проскринировать кукольную популяцию, допустим, померять уровень целлюлазы. Известно, что 95% больных этим наследственным заболеванием демонстрируют повышенную активность целлюлазы. Добавлю еще, что и у 5% здоровых тоже наблюдается повышение. Допустим, у Буратино тест обнаружил такой эффект. Какова вероятность, что он болен?

Ответ:
0.19%

Задачка 2. Известно, что это заболевание наследственное, причем доминантное. У Буратино есть брат, который точно болен.

Посчитать вероятность, что дети унаследовали это заболевание от папы Карло.
Вероятность, что Буратино тоже унаследовал этот ген 50%. Вы решили проскринировать всех Буратиновых братьев, которых, допустим тысяча, тестом из задачки выше. Не забывайте, что наличие гена еще не гарантирует развитие болезни. Проскринировали и у Буратино нашли повышенную активность. Какова вероятность, что Буратино болен?

Ответ:
95%

Задачка 3. Мы ничего не знаем о происхождении Буратино и о его братьях. Но Буратино поташнивает, нос размягчился и опустился вниз и Сова, немного подумав, интуитивно предполагает, что где-то на 30% он скорее болен этим редким наследственным заболеванием, оттуда и симптомы. Делает тест на уровень целлюлазы, как в задачке 1 и он оказывается позитивный. Какова вероятность, что Буратино болен?

Ответ: 89%

Задачка 4. Мы опять знает отягощенную наследственность Буратино (50%) и делаем тест, хоть симптомов пока нет. Тест показывает настолько аномальный высокий уровень целлюлазы, который встречается у 99,5% точно больных. Какова вероятность, что Буратино болен?

Ответ: 99.5%

Вот вам ДНК

Неугомонный любознательный
neuraum находит в сети всякие занимательные штучки. Отвлекает от работы.

На этот раз: Видекурс "Выдели свою ДНК сам".

http://l.lj-toys.com/?auth_token=sessionless%3A1491292800%3Aembedcontent%3A13257115%2616%26%260%26youtube%26DaaRrR-ZHP4%3Ae6963a8a207fd6dfcbc565b9e908cbc1ecb51c66&source=youtube&vid=DaaRrR-ZHP4&moduleid=16&preview=0&journalid=13257115&noads=


Линк на Ютуб

Решила и я показать, вдруг действительно для кого-то будет откровением. Вообще-то в самом начале смешной комментарий был "why are u guys showing this? weveryone learns this in middle and hgihschool so wtf??" , что в общем-то правда. После чего последовала короткая дискуссия "Фейк или не фейк", некоторых стошнило, некоторые умилились, впрочем, теперь все ждут продолжения "cloning tutorial".

В любом случае вам пригодится метод
выделение стволовых клеток з плаценты в домашних условиях. У кого завалялась лишняя плацента в холодильнике, можете приступать.

Я должна об этом написать!

Я тут ставлю один протокол в лаборатории, надо мне. Меряю одну хитрую активность. Протокол, надо сказать, от наших соотечественников в Швеции, хороших коллег. Ну, чтобы поставить реакцию, беру все, как у них, и ткань такую же. Прибор чуток другой и реактивы от другого поставщика. Растираю, экстрагирую, сливаю, калибрую, меряю флуоресценцию, пересчитываю моли-меремоли. Получаю ризалтс в молях отщепленного субстрата за минуту. Смотрю теперь в их статью: тютелька в тютельку!!! Вот это и я понимаю воспроизводимость.

Пару слов о генетических анализах

Тут у нас докторант-бедолага бодается с чужими трансгенами. Вроде точняк трансгены. Проверили саузерном – вставка есть. В рамках кооперации решено отправить растения в дружественную лабораторию, а оттуда любезно запросили в довесок к растениям праймеры для проверки трансгенности ПЦРом. Праймеры, это такие короткие последовательности ДНК (можно даже на бумажке буковки).
А ПЦР это ПЦР. Ну вот докторант придумал праймеры и тестирует ПЦР. Прогнал форез и жалуется на результаты.

Смотрю – маркеры на месте, контрольная полоска с плазмидкой – есть. Дальше начинается бардак. В диком типе – полоска (а не должно быть) , в двух трансгенах – полосок нет (а должны). Зато есть жирнющая полоска правильного размера в совсем негативном контоле, содержащем воду.

Да, -говорит. Для контроля воду брал отдельно, чтобы не загрязнить плазмидой, наносил на гель на расстоянии от плазмиды, чтобы из кармана не перетекло. Воду перед этим проавтоклавировал.Говорю, ну знаешь, бывает и фальш-позитивные, и фальш-негативные, но чтобы в одном эксперименте было и то, и другое, такого не видела. В воде вообще замечательно. Посоветовала попроситься на работу к Люку Монтанье.

Напомню, Люк Монтанье это нобелевский лауреат за ВИЧ. Говорят, последнее время спятил и, видимо, хочет еще одну премию – шнобелевскую. Утверждает, что
вода помнит ДНКу. Вот,- говорю,- ты с этим ПЦРом это экспериментально и докажешь.

И в завершение бонус. Одно уважаемое издание попросило цитату о новых технологиях. Поскольку цитата не подошла – разрешу ее себе опубликовать здесь. Даже две.

"To live, to err, to fall, to triumph, to recreate life out of life" . "Портрет художника в юности" Джеймса Джойса, кто не в курсе. Спрашиваете, причем тут технологии? Ну это Вентер пошалил и процитировал Джойса в геноме бактерии микоплазма.

Еще одна цитата, оттуда же (из генома микоплазмы): "What I cannot build, I cannot understand" – Ричард Фейнман.

Ну тут Вентер оскандалился, потому что оригинальная цитата Фейнмана такая:

“What I cannot create, I do not understand."

Когда Вентеру указали на ошибку, он ответил следующее: "We agreed what was on the Internet was wrong, so we’re going back to change the genetic code to correct it".

Короче, поменял докторант праймеры, все получилось как надо.

Гены и безопасность

Технология работы с генами подошла к такому рубежу, перед которым соображения об опасности "конвернциональных" ГМО выглядят как детский лепет.

Например, я сейчас занята анализом более чем 50ты тысяч генных последовательностей одновременно. Как это делается. Я выделила из растительных тканей РНК. Это несложно. Затем с помощью фермента обратной транскриптазы я "переписала" их в последовательности ДНК. Это называется кДНК. Это тоже несложно. Затем я отправила их на секвенаторную фирму для прочитки. На выходе я получаю обычный текстовой файл, который простой и незамысловатый. Выглядит вот так
) :

>Ps2001

CTTAATAAAACCCCTCGCGTTGATGAAACTTGAAGGGTAA
AAATGAATTAACCCAGGCAA

CTCACCAATATTAGAAGCCTGAGTTGGTGAAAATATTCTA
CTATACACGTGAGGACAATA

>Ps2002

CCATCTGCCACTCATGTCAATCAGAATCAATTATTAAACC
TTACATCCAGTGAAGGGAGG

CGAGAGCCATCTGGAAATTTGTCAACTACCAGCATGACTG
ATGCTCAAGCTGCAGGGAAG

>Ps2003

ACGGGGAAACGGGACGATTCAGAACTGTGTGACAAAGAGA
CTCCGAAAGAGTGAAACGGA

AAAATGGGAAGGAAGAAAGGGTAATGTCGAATTCGAGGAA
TCTCCACCGGACGATTTTGA

TCCGGCGAATCCTTACAAGGATCCGGTGGCTATGTTGGAG
ATGAGGGAACACATCGTCAG

AGAAAAATGGATCCAAATTGAAAAGGCTAAGATTATTAGG
GAAAAGCTTCGTTGGTGTTA

>Ps2004

AATCTTGTTTGAAACAAAAAAGTAATCGCTAAATTCAAAA
TCAATCTTGTACCAGTACAA

TAAAAAGAACAAAAAATAAAACAAACTGCATAACAAGGTA
AAAACAAAATACTCAAACAA

AAAAACAAAACTAAGGAAAAATAGCAACCCACGCCAGAGT
TTGCCGGGAATGTAAGTTTT

Я немного пообрезала последовательности для удобства. Обычно они длиннее. Как мы видим, все последовательности разделены тэгами ">" и содержат какое-то условное название: одно название – условно говоря один ген. Как я уже сказала, в файле сейчас около 50 тыщ последовательностей, но сегодняшние возможности позволяют за раз получить пару миллионов. Что мне с ними делать?

Следующий этап работы с этими последовательностями называется
сравнительная геномика: надо взять эти последовательности и сравнить с уже известными. Я могу сравнивать как поодиночке, так и все одновременно. Я могу также сравнивать как нуклеотидные последовательности, так и виртуально протранслировать эти последовательности в белок и сравнить с базами данных белков. Это все делается
в полностью открытых для всех базах данных и называется это сравнение
BLAST (аббревиатура от Basic Local Alignment Search Tool). На лабораторном жаргоне это называется "бластить". Это не просто, это очень просто. Каждый из вас может это сделать и узнать, на какой ген похожа последовательность >Ps2001.

Для этого надо зайти на
эту страничку и скопировать в окно последовательность, которую охота пробластить, нажать внизу страницы большую кнопку BLAST и подождать. Можете для интереса попробовать с первой последовательностью и убедиться, что она похожа на некую
последовательность из чечевицы. Практически все генные и геномные последовательности хранятся в этой базе данных и каждая из них имеет вот такую учетную карточку, где написано, что это за ген, кем и когда выделен, из какого организма и если известна его функция, то и это тоже указано. Там есть также практически все геномы, которые просеквенированы, а также геномные последовательности вирусов.

Когда я узнала побольше об этой последовательности и она оказалась для меня интересной, я могу выделить ее из генома в целом виде в помощью
ПЦР. Это называется клонирование. Теперь эта последовательность у меня в виде материальной молекулы. Если мне лень возиться с клонированием, то я можу отравить последовательность на фирму и они мне насинтезируют. Я также на свое усмотрение могу изменить нативную последовательность, например с целью поизучать эффект от мутации. Вот тут начинается то, ради чего я пишу этот пост.

Сегодня на рынке несколько фирм, предлагающие подобный сервис. Например
DNA2.0 в Америке или
Geneart в Германии, которые обслуживают всю Европу. Виртуально любой желающий может заказать там молекулу ДНК любого гена на свое усмотрение. И это может быть не добрый растительный ботан с геном гликозил гидролазы, который работает в наглухо зарегулированном научном учреждении, а злодей-биотеррорист с мутантным геном вруса оспы, который в конкурентной гонке за постоянную позицию в университете проиграл, но навыков клонирования не утратил, потому особенно зол.

В общем ситуация ясна и требует назамедлительного решения. Поэтому генные синтезаторы прикинули и решили создать
security coalition, которая называется International Gene Synthesis Consortium (IGSC), а также выработать стратегию защиты. Таким образом, скоро лафа для хобби-бластеров закончится. Все заказанные гены на синтез будут проходить обязательную проверку на потенциальную опасность.