Геном пшеницы

Вот попробуйте только не прочитать. Это ужасно интересно! Значительно интереснее проблем образования.

Тут коллеги
imbg пишут в ЖЖ, что
просеквенирован геном пшеницы. Я уже давно собиралась сказануть на эту тему. Геном пшеницы не прочитан полностью. То есть прочитан, но не расшифрован. Статья в Нейчер осторожно озаглавлена как "
Анализ генома мягкой пшеницы с помощью секвенирования". Проблема в том, что это очень сложный геном.
Triticum aestivum это гексаплоид (шесть наборов хромосом, не шесть штук, а шесть наборов в каждом по семь хромосом. То есть всего 42 хромосомы. Назовем эти наборы ААBBDD ). Я только напомню, что нормальному организму достаточно два набора хромосом, чтобы нормально существовать. Ой, что будет, что будет.

Возник этот гибрид предположительно 8 тысяч лет тому назад. Сначала где-то полмиллиона лет тому назад случилась гибридизационная аномалия между
Triticum urartu (геном АА) с неизвестным зверем, но предположительно это был какой-то
Sitopsis (геном ВВ). Получилась тетраплоидная полба
Triticum dicoccum (ААВВ). Затем эта тетраплоидная полба скрестилась с диплоидным эгилопсом
Aegilops tauschii (геном DD) и тоже там хромосомы не разошлись по домам, а получился такой вот гексаплоидный монстр AABBDD. Затем ее заметили людишки и решили приручить. Вот, решила немного добавить в этом месте. Не исключено, что возожность такой гибридизации обусловлена тем, что людишки уже травки осознанно культивировали. Вот и встретились на полях полба и эгилопс. И согрешили. В результате вот что получилось. Геномы диких трав такие все из себя стройные и последовательные, если речь идет о том, какой ген за каким расположен. Это все эволюционно отточено и законсервировано. Органик-преорганик.

А вот в гибридных геномах уже такого наворочено. Там эти стройные порядки пошли лесом, после доместикации куча генов вообще пропали, а от некоторых остались одни ошметки. Только в одной хромосоме из всех последовательностей – 80% нуклеотидных повторов и всяких транспозонов. Свалка какая-то, причем это ж не просто так себе ДНК, это набор мигрантов, которые шляются по геному и вырубают гены.

Повторы – это большая проблема для секвенирования. То есть прочитать это все можно, но сложить воедино очень сложно, почти невозможно. Смотрите. Чтоб прочитать ДНК, ее режут в хлам и читают по кускам. Допустим по 100 – 500 нуклеотидов. Потом биоинформатики сидят и склеивают это все воедино. Как это примерно выглядит. У нас на выходе куски c похожестью на концах:

ATGACTACGACTAC
GATA

GATAGTACTAGCAT
GCAT

GCATCATACGATCAGAGTC

Предполагается, что эта похожесть – это концы одного и того же гена. Вот по ним склеивают и называют это ессемблинг. Это очень упрощенная схема, на самом деле похожие куски длиннее, алгоритм сложнее, но суть такая. Теперь представьте, что в геноме повторы. Алгоритмы эти повторы не распознают и в основном склеивают всякие химеры от фонаря. Поэтому за основу реконструкции берут геномы ближайших родственных диких трав и других злаковых родственников, вроде риса и кукурузы. И пытаются склеивать, подглядывая за другими матрицами. Что оказалось?

В целом, кроме того, что потеряно много генов, некоторые полезные гены "размножились", причем это гены преимущественно из генома эгилопса. Среди них в пшеничном хозяйстве пригодились детальки от фотосинтетической машины, запасные белки, транспозонов горсть, несколько систем защиты и пыльцевые аллергенчики (уууу). Транспозоны тоже без дела не сидели, и попрыгали хорошенечко, вырубив гены и переведя их в статус молчащих псевдогенов. Но геном тоже не дурак, он важные гены – факторы транскрипции, забэкапил, чтоб была функциональная копия на всякий случай. За последние 50 лет это все еще хорошенечко побомбили химическими мутагенами и радиацией, и вуаля! – получилась булочка.

Я вам скажу, что генные инженеры по сравнению с последствиями этого монстрозного процесса доместикации пшеницы – они просто дети. Ну вот если бы кому взбрело в голову встроить парочку аллергенчиков с целью улучшить, скажем опыляемость, так забили бы камнями. А если представить себе, что такого мутанта вдруг сконструировали искуственно и предложили скушать, то мировое народное восстание поднялось бы.

А так вообще это геномное косое монстрище теперь священная корова у гринписа – дескать, не трожьте генноинженеры, это Хлеб, это святое.

Advertisements

О синтетической биологии

Когда я пишу о ГМО, то чаще всего имею в виду три десятка наименований трансгенных растений. Буквально недавно
flavorchemist придумал взять у меня интервью, которое не все поместилось на прокрустовом ложе. Как раз я сказанула одну вещь, которая не вошла в конечную версию – "
Я бы охарактеризовала текущую эпоху (в биотехнологии) как время накопления капитала знаний".

А я считаю, что это тема важная и актуальная. Смотрите сюда. Генная инженерия распахивает ручищи до размеров, которые называются
синтетическая биология. Это вовсе не формальный союз генетиков, ботаников и физиков с химиками. Это генетическая инженерия, которая не отдельные гены туда-сюда переносит, а изучает строение целых геномов, принципы их функционирования и приближается к тому, чтобы клепать совершенно новые организмы на свое усмотрение.

Смотрите сначала на эту картинку

Это распределение темы "синтетическая биология" в различных научных сферах. Как мы видим, вопросами синтетической биологии занимается преимущественно фундаментальная биохимия, молекулярка, химия, физика, информатика, а прикладная сфера ограничена микробиологией, возможно еще фармакологией. Растительная синтетическая биология еще в загоне, а в пищевой технологии и сельском хозяйстве только первое приближение.

Но работа, как вы видите, кипит. Теперь смотрим еще одну картинку, где она кипит. 40 стран мира задействованы в исследованиях на поприще синтетической биологии. Найдите свою страну на карте и сделайте правильные выводы.

В этой статье (всем доступной) есть еще много интересных картинок в хорошем разрешении, кто это финансирует, о чем статьи и, главное, что у нас там с биологическими и другими этическими рисками. Угу.

Перепись населения

Небольшой отрезвляющий пост для любителей транскриптома. Подобную информацию уже где-то раньше встречала, но не помню где и, кажется, неполную. А тут опять наткнулась в
Genom express. Пусть теперь тут лежит.

Поситали, значит, мРНКу и белочки, которые с нее считываются. Вот что обнаружилось (прошу прощения за корявый перевод, некогда возиться):

Как мы видим, выраженная в цифрах скорость транскрипции в этой эпической картине занимает весьма скромное место: происходит медленно, быстро валится, а при этом трансляция разворачивается во всей своей красе. Самое вкусненькое, конечно же, происходит между тыщами белочков , которые находятся в один момент в клетке (не перестаю удивляться: куда это все помещается?!), что-то делают: синтезируют, передают сигналы и молекулы, строят комплексы, что-то разрушают, куда-то встраиваются, катализируют, связываются, транспортируются из клетки, в клетку, в разные части клетки и тыды и тыпы.

В этом смысле, регуляция трансляции привлекает все больше внимания.

По материалам Schwanhausser, B. et al. (2011) Global quantification of mammalian gene expression control. Nature

Геномы

Я тут за работой всех нобелей-шнобелей пропустила. Но у меня есть другие новости.

Геномы секвенировать все еще модно. Создаются консорциумы, которые делят куски генома между собой, секвенируют и празднуют потом. Наш институт тоже отхватил пару хромосом ячменя на прочитку и страшно доволен. Каждый новый прочитанный геном это событие. Результаты пробуют втиснуть в Нейчур – это престижно. Дальше я буду говорить о растительных геномах – мне это ближе.

Пафосный геном

Буквально недавно
картофельный консорциум отчитался о прочитке генома картофана. Летом похвастались
об этом в Нейчур.

Зачем нам геном картошки:
The potato genome sequence provides a platform for genetic improvement of this vital crop.

Геном, как пиар

Где-то год назад
прочитан геном какао. Фирма Марс прочитала. Та, которая шоколадные батончики, ну вы в курсе. И что интересно, фирма выложила геном в открытый доступ, что для фирм вроде Марса не совсем характерно. Правда,
чтобы получить доступ, надо поклясться, что (внимание, это важно!) слямзив оттуда кусок генома, никто не будет его потом патентовать. В общем это такой симпатичный жест от фирмы с целью предотвратить генное патентование вообще.

Зачем нам геном какао:
The release of the cacao genome sequence will provide researchers with access to the latest genomic tools, enabling more efficient research and accelerating the breeding process, thereby expediting the release of superior cacao cultivars.

Геном, как хобби

В тем временем фирма
Medicinal Genomics без лишнего шума и помпы и без каких-либо пафосных междусобойчиков прочитала геном конопли. Думаете они в Нейчур написали? А вот и нетушки. Они написали об этом в Amazon, куда выложили в
открытый доступ всем любителям конопли. Правда это всего-лишь четыреста миллионов не сбитых в кучу коротких кусков. Хобби-биоинформатики могут сами поковыряться в этом паззле и собрать геном. Есть также вариант предварительного ессемблинга. А если у кого еще есть терпение, то может подождать – осенью обещают выпустить в виде Apps для айпеда.

Зачем нам геном конопли:
McKernan hopes his company’s data will help scientists explore a few of the others, and perhaps guide plant breeding programs to generate new Cannabis strains.

Удачи!

Один ген-один признак.

Пост про современное
понятие гена поднял целый пласт новых вопросов. В крайнем варианте возражения можно просуммировать так: ну раз там так все сложно, есть ли у нас основания вообще ставить ген краеугольным камнем развития признака? Может пора отменить формулу "один ген – один признак"?

Попробую навести порядок в определениях и немного разложить по полочкам. В конце концов ген, как краеугольный камень в развити признака, нам важен прежде всего в его предсказательной силе. И есть примеры, когда мы можем точно предсказать, будет ли признак наследоваться, а иногда это сложно сделать. И я объясню

Давайте чисто интуитивно прикинем: Мы наблюдаем у человека наследственное заболевание серповидно-клеточную анемию. Это моногенное заболевание, которое вызвано мутацией в гене гемоглобина. Особи, у которых обе копии (аллели, а их всегда две) гена дефектные, ВСЕГДА будут демонстрировать признак. Мы можем точно предсказать в цифрах, процентах вероятности, как будет наследоваться этот признак в потомстве.

Таких примеров наследственных заболеваний есть довольно много.

Немного более сложная ситуация, если признак кодируется двумя генами (аллелями). Но и в этом случае мы можем предсказать, как он будет наследоваться. Еще сложнее с полигенным наследованием. Предсказать наследование признака еще сложнее.

Теперь внимание. Если мы заглянем в клетку и разберем ее на части, то обнаружится, что ее молекулярные системы можно хотя бы грубо классифицировать.

I.
Метаболизм (синтез и деградация).

1. Метаболизм

карбогидратов
углеводов.

2. Метаболизм энергетически емких соединений.

3. Метаболизм липидов.

4. Метаболизм нуклеотидов.

5. Метаболизм аминокислот.

6. Метаболизм гормонов.

7. Метаболизм витаминов.

8. Метаболизм вторичных метаболитов.

II.
Обработка генетической информации.

1. Транскрипция.

2. Трансляция.

3. Сворачивание, сортировка и деградация белков.

III.
Обработка внешней информации.

1. Мембранный транспорт.

2. Восприятия и передача молекулярных сигналов.

IV.
Внутриклеточные процессы.

1. Обслуживание клеточного деления.

2. Обслуживание клеточного роста и растяжения.

3. Внутриклеточная архитектура.

4. Умирание клетки.

5. Адаптация к нетипичным условиям.

6. Реакция на заболевания.

V.
Еще неизвестные функции.

При желании каждую категорию можно разбить еще на дополнительные подкатегории. Получится длинный список, но я приведу буквально один пример.

I.
Метаболизм (синтез и деградация).

1. Метаболизм

карбогидратов
углеводов.

а. Гликолиз. Гены: алкогольдегидрогеназа, Glyceraldehyde 3-phosphate dehydrogenase, Pyruvate decarboxylase isozyme, aldose 1-epimerase, Glucose-6-phosphate isomerase, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase и так далее…

б. Цитратный цикл. Гены: isocitrate dehydrogenase, succinate dehydrogenase, dihydrolipoamide dehydrogenase и т.д.

в. Пентозо-фосфатный цикл.

г. Метаболизм фруктозы и маннозы.

д. Метаболизм галактозы.

э. Метаболизм крахмала.

е. Метаболизм аскорбатов.

ж. Метаболизм аминосахаров.

и. Метаболизм пирувата.

й. Метаболизм глиоксилатов.

к. Метаболизм бутаноатов

л. Метаболизм инозитола.

Фактически это грубая классификация генов, которые присутствуют в геноме и включаются время от времени или работают постоянно. Все эти системы могут быть или связанными между собой или независимыми. Степень взаимодействия систем тоже разная, наблюдается также иерархия в их работе.

Пример:

Клеткой получен сигнал извне (III.2). Включились гены синтеза гормона (п. I.6). Гормон провзаимодействовал с генами передачи внутриклеточного сигнала (п.III.2). Сигнал передан до ядра и включена машина обработки генетической информации (п.II.1.2.3), котрая обслуживает процесс деления клетки (п.IV.1). Наблюдаем в микроскоп процесс деления клетки.

Мы также можем догадаться, что кроме получения и обработки внешних сигналов, целый ряд процессов задействован в поддержании внутриклеточного гомеостаза и обслуживание рутинных жизненно-важных функций: архитектура органелл, топливо и так далее.

Вернемся к началу "один ген-один признак". В самом простом варианте можно предположить, что даже если исключить все сложные молекулярные взаимодействия, достаточно мутации в одном ключевом гене, который стоит по иерархии в самом низу и обеспечивает рутинные текущие функции, ну, например, актин (внутриклеточный скелет), как мы будем наблюдать конкретный признак – поломку процесса расхождения хромосом в процессе деления клетки. В микроскопе видим дефект деления клетки.

Отсюда теперь можно продолжать усложнять. Делаем шаг наверх по иерархической леснице. Если промутирует ген фактора транскрипции, который регулирует включение гена актина (хоть сам ген будет в целости и сохранности), то мы тоже будем наблюдать тот самый признак – поломку процесса расхождения хромосом. В микроскопе видим дефект деления клетки.

Двигаемся дальше. Фактор транскрипции цел и невредим, ген актина цел и невредим. Но, есть поломка в цепи передачи сигнала, который включает фактор транскрипции. Фактор не включает ген актина. В микроскопе видим дефект деления клетки.

Так мы можем двигаться выше и выше, но нам теперь главное нащупать потолок. Вводим опять ключевого игрока – внешнюю среду. Допустим, сигнал вообще не поступил. Пример с актином становится не очень удачным, потому что в норме актин в клетке должен присутствовать практически всегда, неависимо от внешних условий, иначе клетке совсем капут. Лучше возмем другой пример, когда жизнедеятельности клетки зависит от внешних сигналов.

У меня есть такой пример: белок, который кодирует хитрую киназу. Это фермент, который цепляет остатки фосфора на другие белки и таким образом меняет их физико-химические свойства, активирует или деактивирует. Следите за руками.

В среде закончился сахар и клетке исчерпались запасы энергии. Включились факторы транскрипции и включили ген этой киназы, которая должна все в клетке перенастроить на использование альтернативных источников энергии и параллельно включить энергосберегающий режим.

Эта киназа прежде всего активирует себя. Затем выключает ряд факторов транскрипции, которые включают гены, обеспечивающие "сжигание энергии". Одновременно она активирует факторы транскрипции, которые включают гены, ответственные за сберегание энергии и метаболизм альтернативный карбогидратов. Также напрямую активирует целый ряд ферментов, которые метаболизируют альтернативные источники энергии. То есть наблюдается массивное перепрограммирование.

Вот как генное взаимодействие выглядит в первом приближении минус внешние сигналы.

Поломка в любом из путей перепрограммирования приведет к сходному дефекту-признаку, начиная с момента восприятия сигнала. Это мы сейчас говорим только о клетке. В контексте развития организма (в частности эмбриона у моего любименького гороха), эта киназа еще имеет временнОй профиль. На ранних стадиях развития она воспринимает один сигнал, на поздних – другой. И в зависимости от этого регулирует разные биохимические пути. Тут внешний сигнал играет ключевую роль.

Важное лирическое отступление.

Я выше описала гены, которые кодируют белки, которые выполняют каждый свою роль. В какой-то момент у читателя складывается ошибочное представление, что все зависит только от генов или от насинтезированных с них белков. Давайте и тут разберемся. Тут мы приближается к важному моменту: доля участия генов и окружающей среды в развитии признака. Вы наверняка уже подобное встречали, когда говорят, что признак, например, на 50% процентов зависит от генов, а на 50% от окружающей среды. И как мы догадываемся, это соотношение может меняться от " полной генной зависимости" (серповидноклеточная анемия) до "признак вызывается только внешними условиями" (удар молотком по пальцу) с кучей промежуточных вариантов в зависимости от сложности молекулярного взаимодействия и места генного продукта в системной иерархии.

Крейг Вентер и искусственная жизнь

В редакцию пишут: "Прокомментируйте пожалуйста в своём блоге эксперимент в Craig Venter Institute, Maryland; по созданию исскуственного генома и выращивании «two small species of Mycoplasma». Я не думаю что вы сможете пройти мимо такого события в генетике. А читать ваши комментарии всегда интересно — вы популярно объясняете."

Я действительно не могу пройти мимо такого события в генетике и попробую изложить если не интересно, то хотя
бы понятно.

Сначала пару слов о Крейге Вентера.

Я простоянно о нем
жуЖЖу, уж простите. Это такой харизматичный дядька, которого половина научного мира сильно недолюбливает за излишнюю активность и называет бессовестным конъюнктурщиком , а другая сильно уважает, хоть он и нервный. То он нагло влезет в программу секвенирования человеческого генома с новой идеей супербыстрого "
shotgun"- секвенирования и портит всю малину медленного и вдумчивого освоения грантов. Потом со скандалом уходит из фирмы Celera Genomics и едет кататься на яхте Sorcerer II по маршруту Дарвина, при этом по ходу вылавливая из океанов вирусы сетями. Покатался и открыл новые 1000 микроорганизмов и вирусов, которые плавают в водах океана.

Пока катался, дочитали
его личный геном. Геном выложили в сеть в виде интерактивного постера для особо любопытных. Вызов? Вызов. После этого Вентер организовывает свой
Craig Venter Institute и ставит перед собой новый челендж –
синтетическая геномика.

Зачем все это? Во-первых, это даст ответ на вопрос, действительно ли мы правильно понимаем основу жизни, как работу реплицирующегося генома в "мешке с ферментами", то есть клетке? Во-вторых, если это так, это даст возможность создавать организм с точно заданными свойствами. Не зря в институте Вентера
тема синтетической геномики привязана к биоэнергетике. Цель – создать искусственный организм, способный насинтезировать что-то энергетически полезное. Топливо, например.

Краткая предистория.

Прежде чем создавать что-то новое, надо разобраться, как работает уже готовое. В 1977 году был просеквенирован впервые геном бактериофага φX174, а уже в 1995 году полностью прочитан первый бактериальный геном
Haemophilus influenzae. Одновременно накапливался материал о роли многих генов в этом геноме. В то же время прочитан геном бактерии
Mycoplasma genitalium . Оказалось, что эта бактерия содержит самый маленький геном из всех известных микроорганизмов, который кодирует всего 485 белков. Вентер взялся к созданию так называемого минимального генома. Из генома
Mycoplasma genitalium по очереди выключались гены и оказалось, что если из
485 вырезать сотню, то бактерия все еще способна жить и размножаться. Итого, минимальный геном организма, который может размножаться, теоретически может содержать всего 382 гена. Этого достаточно.

Вторая задача, которая стояла перед криэйторами, проверить возможность пересадки геномов из одного вида бактерии в другой. На этот раз пришлось переключиться с
Mycoplasma genitalium на
Mycoplasma mycoides.
Mycoplasma genitalium характеризуется слишком медленным ростом у условиях
in vitro. Итак,
в 2007 году удалось провести успешную трансплантацию генома из
Mycoplasma mycoides в
Mycoplasma capricolum. Я не буду вдаваться в детали, скажу только, что пришлось повозиться, но получилось.

Итого, по факту у нас представления о минимальном геноме, а также разработан метод трансплантации геномов. Кроме того, искусственный синтез генов вполне себе лабораторная рутина, как и сборка их в кучу. Создания искусственного организма был только вопросом времени.

Итак, новую жизнь в студию!

Сначала искусственно насинтезировали нужные гены минимального генома и встроили их в кассеты длинной в 1000 нуклеотидов для размножения в
E.coli. Затем собрали их в куски побольше по 10 тыщ нуклеотидов, затем в куски по 100 тыщ, и, наконец, собрали его окончительно в дрожжах и перенесли в бактерию
Mycoplasma mycoides оклематься. Конечный размер генома, который назвали
JCVI-syn1.0 (JCVI от
John
Craig
Venter
Institute) составил около
1 млн отдельных нуклеотидов, который затем трансплантировали в клетку
Mycoplasma capricolum из которой предварительно удалили родной геном, как делали раньше. Главная технологическая трудность работы – это постоянная перепроверка и перепрочитка синтетических молекул ДНК. Дело в том, что в процессе сборки отдельные нуклеотиды могут мутировать и тогда ничего не получится.

Что получилось. Клетка
Mycoplasma capricolumу нас уже была, внимание, ее никто не создавал искусственно, взяли готовую,

созданную всевышним
. Из нее толко вытряхнули собственное геномное содержимое и внедрили JCVI-syn1.0, после чего клетка успешно считала геном, насинтезировала того, чего надо и начала размножаться. Затем этот геном из нее опять выделили и перечитали. Оказалось, что за время синтеза и трансплантации смутировало 8 новых нуклеотидов, впрыгнул мобильный элемент генома – транспозон из
E.coli и произошло 85 удвоений генов, при этом вырубились 2 гена, которые очевидно не явились критическими.

Перспективы.

Предоставлю слово самому Вентеру.
If the methods described here can be generalized, design, synthesis, assembly, and transplantation of synthetic chromosomes will no longer be a barrier to the progress of synthetic biology. We expect that the cost of DNA synthesis will follow what has happened with DNA sequencing and continue to exponentially decrease. Lower synthesis costs combined with automation will enable broad applications for synthetic genomics. We have been driving the ethical discussion concerning synthetic life from the earliest stages of this work. As synthetic genomic applications expand, we anticipate that this work will continue to raise philosophical issues that have broad societal and ethical implications. We encourage the continued discourse.

(вольный перевод): Если обобщить описанные здесь методы, то дизайн, синтез, собрание и трансплантация синтетической хромосомы больше не будут препятствием для прогресса синтетической биологии. Мы ожидаем, что с расходами на синтез ДНК произойдет то, что произошло со стоимостью секвенирования ДНК, которое по-прежнему экспоненциально уменьшается. Низкие расходы на синтез в сочетании с автоматизацией позволит найти широкое применение для синтетической геномики. Мы вели этические дискуссии о синтетической жизни с самых ранних этапов этой работы. Мы также ожидаем, что с расширением возможностей применения синтетического генома, будут подниматься философские вопросы, которые имеют широкие социальные и этические последствия. Мы воодушевленно потираем ручки в продолжение дискурса (

демонически ржет
).

Гены и безопасность

Технология работы с генами подошла к такому рубежу, перед которым соображения об опасности "конвернциональных" ГМО выглядят как детский лепет.

Например, я сейчас занята анализом более чем 50ты тысяч генных последовательностей одновременно. Как это делается. Я выделила из растительных тканей РНК. Это несложно. Затем с помощью фермента обратной транскриптазы я "переписала" их в последовательности ДНК. Это называется кДНК. Это тоже несложно. Затем я отправила их на секвенаторную фирму для прочитки. На выходе я получаю обычный текстовой файл, который простой и незамысловатый. Выглядит вот так
) :

>Ps2001

CTTAATAAAACCCCTCGCGTTGATGAAACTTGAAGGGTAA
AAATGAATTAACCCAGGCAA

CTCACCAATATTAGAAGCCTGAGTTGGTGAAAATATTCTA
CTATACACGTGAGGACAATA

>Ps2002

CCATCTGCCACTCATGTCAATCAGAATCAATTATTAAACC
TTACATCCAGTGAAGGGAGG

CGAGAGCCATCTGGAAATTTGTCAACTACCAGCATGACTG
ATGCTCAAGCTGCAGGGAAG

>Ps2003

ACGGGGAAACGGGACGATTCAGAACTGTGTGACAAAGAGA
CTCCGAAAGAGTGAAACGGA

AAAATGGGAAGGAAGAAAGGGTAATGTCGAATTCGAGGAA
TCTCCACCGGACGATTTTGA

TCCGGCGAATCCTTACAAGGATCCGGTGGCTATGTTGGAG
ATGAGGGAACACATCGTCAG

AGAAAAATGGATCCAAATTGAAAAGGCTAAGATTATTAGG
GAAAAGCTTCGTTGGTGTTA

>Ps2004

AATCTTGTTTGAAACAAAAAAGTAATCGCTAAATTCAAAA
TCAATCTTGTACCAGTACAA

TAAAAAGAACAAAAAATAAAACAAACTGCATAACAAGGTA
AAAACAAAATACTCAAACAA

AAAAACAAAACTAAGGAAAAATAGCAACCCACGCCAGAGT
TTGCCGGGAATGTAAGTTTT

Я немного пообрезала последовательности для удобства. Обычно они длиннее. Как мы видим, все последовательности разделены тэгами ">" и содержат какое-то условное название: одно название – условно говоря один ген. Как я уже сказала, в файле сейчас около 50 тыщ последовательностей, но сегодняшние возможности позволяют за раз получить пару миллионов. Что мне с ними делать?

Следующий этап работы с этими последовательностями называется
сравнительная геномика: надо взять эти последовательности и сравнить с уже известными. Я могу сравнивать как поодиночке, так и все одновременно. Я могу также сравнивать как нуклеотидные последовательности, так и виртуально протранслировать эти последовательности в белок и сравнить с базами данных белков. Это все делается
в полностью открытых для всех базах данных и называется это сравнение
BLAST (аббревиатура от Basic Local Alignment Search Tool). На лабораторном жаргоне это называется "бластить". Это не просто, это очень просто. Каждый из вас может это сделать и узнать, на какой ген похожа последовательность >Ps2001.

Для этого надо зайти на
эту страничку и скопировать в окно последовательность, которую охота пробластить, нажать внизу страницы большую кнопку BLAST и подождать. Можете для интереса попробовать с первой последовательностью и убедиться, что она похожа на некую
последовательность из чечевицы. Практически все генные и геномные последовательности хранятся в этой базе данных и каждая из них имеет вот такую учетную карточку, где написано, что это за ген, кем и когда выделен, из какого организма и если известна его функция, то и это тоже указано. Там есть также практически все геномы, которые просеквенированы, а также геномные последовательности вирусов.

Когда я узнала побольше об этой последовательности и она оказалась для меня интересной, я могу выделить ее из генома в целом виде в помощью
ПЦР. Это называется клонирование. Теперь эта последовательность у меня в виде материальной молекулы. Если мне лень возиться с клонированием, то я можу отравить последовательность на фирму и они мне насинтезируют. Я также на свое усмотрение могу изменить нативную последовательность, например с целью поизучать эффект от мутации. Вот тут начинается то, ради чего я пишу этот пост.

Сегодня на рынке несколько фирм, предлагающие подобный сервис. Например
DNA2.0 в Америке или
Geneart в Германии, которые обслуживают всю Европу. Виртуально любой желающий может заказать там молекулу ДНК любого гена на свое усмотрение. И это может быть не добрый растительный ботан с геном гликозил гидролазы, который работает в наглухо зарегулированном научном учреждении, а злодей-биотеррорист с мутантным геном вруса оспы, который в конкурентной гонке за постоянную позицию в университете проиграл, но навыков клонирования не утратил, потому особенно зол.

В общем ситуация ясна и требует назамедлительного решения. Поэтому генные синтезаторы прикинули и решили создать
security coalition, которая называется International Gene Synthesis Consortium (IGSC), а также выработать стратегию защиты. Таким образом, скоро лафа для хобби-бластеров закончится. Все заказанные гены на синтез будут проходить обязательную проверку на потенциальную опасность.